Third International Congress on Biological and Health Sciences, Afyonkarahisar, Turkey, 14 - 16 April 2023, pp.185, (Summary Text)
Mycobacteriosis in aquarium fish is caused by several species of bacteria from the Mycobacteriaceae
family, described as nontuberculous mycobacteria (NTM) some of which have zoonotic character. They
can be a source of risk for public health, especially for people engaged in aquarium fish breeders. Discus
fish are one of the most popular and expensive aquarium fish favoured by aquarium hobbyist. In this
study, a discus fish that was sent to our laboratory from a farmer who breeds discus fish as an amateur
in Samsun was microbiologically analysed for NTM. For this purpose, tissue samples taken from the
internal organs (spleen, liver and kidneys) of the fish were homogenized and exposed to the
decontamination process. Following that 10 μl of decontaminated homogenate were inoculated into
Lowenstein-Jensen medium and incubated at 30 ± 1 °C. The media were checked daily for 2 months.
Suspicious colonies were examined microscopically by Ziehl-Neelsen (ZN) staining and subcultured.
For molecular identifications, the hsp65 (heat shock protein) gene region were amplified using Tb11
(ACCAACGATGGTGTGTCCAT) and Tb 12 (CTTGTCGAACCGCATACCCT) primers and
sequenced with the same primer pair. The white colonies were observed on the Lowenstein-Jensen
medium and these colonies were positive for acido-resistant bacilli (ARB) by ZN stain. In PCR assay
targeting the hsp65 gene, a PCR product of the expected sized (439 bp) was observed and isolate was
evaluated as Mycobacterium sp., The sequencing of the hsp65 gene region of the isolate was found to
be 100% similar to Mycobacteroides abscessus strains with accession numbers AY859675, AP018436,
EU266576, DQ987724 and AB548605 in the GenBank database. As a result, the isolate was identified
as M. abscessus and deposited in GenBank database with accession number OQ540499.